linux

Hi I want to receive application special log in the command prompt of windows I tried it adb -d logcat com.mycompanyname.demoapp: I *: S but did not work for me, too much log printing was going on It was hard to find my app specific logs. I want to print my app specific log command prompt. logs logs (you call log class methods in your app Using the string as the string used when doing so), not the package name of the app.

I need to remove an object that satisfies the condition, I am able to update the base's object ( "Tweet_id": "1", "a": "b"}, {"tweet_id"), which is as follows: PUT twitter / twit / 1 {"list" "123", "a": "f"}}} Post / Twitter / twit / 1 / _update {"script": "foreach (item: ctx._source.list) {if item ['tweet_id'] = it is working > I am doing this posted / twitter / tw ("Item": "foreach" (item: ctx._source.list) {if item ['tweet_id'] == tweet_id) {ctx._source.list.remove (item);}} "," Params ": {tweet_id": "123"}} but it is not working and giving this error, ElasticsearchIllegalArgumentException [script Failed to execute]; Nested: concurrent reformation exceptions; Error: ElasticsearchIllegalArgumentException [iled for executing FA script]; Nested: ConcurrentModificationException I delet...

Using this example as a guide: I tried to create a plan with several axes which was using twinning instead of twinx. However, in both one- par2 top of the axes and the position appears in both par1 overlapping on top What am I doing wrong? plt host = host_subplot (111, axes_class = AA.Axes) as a.A. pl..subplots_adjust Import matplotlib.pyplot as mpl_toolkits.axes_grid1 import host_subplot import Parl = Hostktwiny (from mpl_toolkits.axisartist (down = 0.2)) par2 = host.twiny () new_fixed_axis = par2.get_grid_helper (). New_fixed_axis par2.axis ["bottom"] = new_fixed_axis (loc = "bottom", axis = par2, = offset (0, -40)) par2.axis ["bottom"]. Toggle (all = true) host.set_xlim (0, 2) host.set_ylim (0, 2) host.set_ylabel ( "distance") host.set_xlabel ( "density") par1.set_xlabel ( "Temperature") par2.set_xlabel ( "Velocity") p1, = host.plot ([0, 1, 2], [0, 1, 2], label = "density") p2, = Par1.plot ([0, 3,...

You have been given a DNA sequence, and some enzymes, a DNA sequence is like this: ATGCTGCTATGCATGCAGTGACT , and you are given an enzyme that can remove the AT and GC sequences. In this way, you must first remove all the events of AT from DNA and then improve DNA and apply the next enzyme to remove all GC incidents. The problem will be the issue string, which you get to improve the fragments extracted by the previous enzyme. Input The first line input contains an integer N, which represents the number of enzymes. DNA sequence in the first line is the input B1, B2, B3 ... BN in the next T lines. Output The sequence for given input DNA, the last improved DNA in which single bar B1, B2, B3 ... BN . From the removal of all incidents, a single line is produced. If DNA is completely eaten then print 0 indicates there is no DNA balance. Obligations 1 & lt; = N & lt; Example: 1: Input: 2 ATACGCATGACGATGCATGCAGCAT ATA GC Output: CATGACGATATAAT ...

I have a problem using jqueryui resize and draggable same elements should work together? In this version, I can resize the image, but I can not drag it. The idea is to be able to pull the image in the large Divi, but it does not change the big internal Divel it should be the end result would be a worthy how to pull a signal to change the size in the same element Is here in it here HTML & lt ?. Div id = "container" & gt; & Lt; Div id = "region" & gt; & Lt; div class = "testi" & gt; & Lt; img class = "imageHere" width = "200" src = "https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEibQpLmEpS580SE5rzQG3aCU_X7c524Y4yOvwmFQt4swgUDruH4e-2ZXrPaT6oEgs6ovQsTBqK3ZWY5LhO-kAWryNPDQPkLx4J7_f1OGIgZJ3R9soT-OeKvqq7v16PLSnY6lJ6RzX3VFCo/ /google-logo-874x288.png" / & gt ; & Lt; / Div & gt; & Lt; / Div & gt; css #area {status: absolute; Top: 67px; Left: 75px; Border: Sol...

I have a WCF service (project output type-window application) that is hosted as a Windows service. All client and server logic is in the C # code and I do not have any configuration files. I need to enable wcf tracing without using the config file. How can I do this? You can configure the program that you file your .config If you initialize your service, just add this code (customize it according to your logging requirements): var listener = new XmlWriterTraceListener ("Log.xml"); Debug.Listeners.Add (listener); Note that you can set all properties (log level, for example), as you would with the attributes in your .config file Do: debug Etoflu = true; Listner. TraceOutputation = Traceaptis. call stack; You can also add your custom filter: listener.filter = new MyCustomTraceFilter ();

I have a Spring MVC Rest method which, from time to time, said in my application to vote for notifications in the background goes. I would like this pattern to not affect the session method so that users are automatically logged out, if they leave the browser window without any contact. Is it possible to annotate a Spring MVC controller method that this session will not affect timeout? AFAIK, the session timeout is managed at the container level, above any spring controllers and any java The EE move does not know that some requests should not reset the timeout of the session. The only thing I can imagine is to report the timeout in the front-end application: if no user interaction for the scheduled time-end, a disconnection request for front-end automatically Sends.